Archives

Categories

Y
Y

De Bruijn Graph of a Palindromic Sequence

Homolog.us blog is written by professional janitors dedicated to clean up US science. During lunch breaks and other time off from the job, we discuss bioinformatics. The name 'homolog.us' is not a spelling mistake, but is derived by taking Arabic translation of the 'O' in the original word.

Please follow us on twitter – @homolog_us.

-------------------------------------------------------------------------------------------------------------

Palindromic nucleotide sequences are those matching their reverse complements. Here is an example -“ATACGTCATTCAAATATGTATATACATACATATTCGAATATGTATGTATATACATATTTGAATGACGTAT”. Another one is “CATGTGACTTTATAGCAGCATGCTGCTATAAAGTCACATG”. We did not make those sequences up. They are taken from chromosome 1 of human genome.

Here is the de Bruijn graph of one of the above sequences with 7-mers. We are using the convention of showing only the lexicographically smaller 7-mer.

The above graph is constructed in a hurry and may have one or two errors, even though the general structure is correct.

Enjoy !!




-------------------------------------------------------------------------------------------------------------
Heroes and Heroines of New Media--2014

I am strongly influenced by Charles Hugh Smith, who runs his insightful social blog of Two Minds. I hope he will not mind, if I copy his style of acknowledgement to the supporters of our blog.

Our blog is deeply honored by the generous contribution of the following readers. Without their patronage, this site would go away.

Outstandingly Generous:  
Amemiya C. Schnable J. Bowman B.

We are also looking for subscribers to get help to finish the tutorials. Please see this post for details.

1 comment to De Bruijn Graph of a Palindromic Sequence

  • Rayan

    Case analysis of graph structures is always a fascinating topic. I didn’t check the graph for errors (surely there are simpler examples of palindromes in dBGs, with smaller sequences and smaller k values). In the figure, it is worth noting that the first and last nucleotides of the red sequence are not part of the palindrome.

Leave a Reply

  

  

  

You can use these HTML tags

<a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>